Chapter 1. Structure of nucleotides and properties. 1-4, 40, 41a-c, 73a, 88, 89ac, 147, 148, 204, 217, 239
Chapter 2. Conformational analysis of nucleotides. 5, 7, 8, 75, 149, 176, 218, 240
Chapter 3. A & B DNA. 9, 10, 11, 18 (see the Chapter notes), 41d-f, 46, 73bc, 74, 79, 98, 99, 179, 219, 220, 221
Chapter 4. A, B or Z DNA. 16, 29, 60, 180
Triplexes. 19a, 20, 38, 61, 62, 68, 103, 119, 120, 150, 151, 181, 183,
241
Chapter 5. Spectroscopic and
chemical probes. 23, 17, 23, 110 (only DEPC), 182,
223, 242
Q. What sequential NOESY assignments are possible for A, Z, triplex, and
tetraplex DNA? (Need to use pdb
structures on the Chem520 Web account and RasMac, or
Chime to make the measurements).
Chapter 6. Thermodynamics. 12, 13, 14, 15, 26, 30, 71, 152, 184, 199, 224, 225, 243,
Chapter 7. Supercoiling. 19, 27, 28, 63, 69, 77, 87, 122, 123, 141, 153, 154, 185, 200, 226, 244
Chapter 8. Intercalation and minor groove binding. 202 , 245
Chapter 9. Bending. 64,
70, 121, 186, 227, 246
Chapter 10-12. Chemical Synthesis of
nucleosides, DNA, RNA and analogs.
39 (reagents 4-9,11-13), 49, 53, 54, 144, 164, 165,
178, 198, 207,208, 247, 248, 249, 251, 252
a. What building blocks, supports and strategy would you use to make a 3'-3'
linked oligonucleotide typified by that shown in problem 68?
b. How would you make the solid phase synthesis building block for the
unnatural anomer of thymidine (pblm 83)?
Chapter 13. Nucleotide Biosynthesis and metabolism. 43, 90, 91, 92, 93, 124, 125, 142, 155, 156, 157, 158a, 187, 253, 254,
Chapter 14. Enzymatic synthesis of DNA and RNA, and
protein: 45, 51, 56, 76b,c, 89 94, 95, 96, 97, 102, 106, 107, 114, 116,126,
127, 128, 150, 159, 160, 161,163, 189, 191, 201,
a. In the technique of silent mutagenesis, restriction sites can be introduced
into a DNA sequence without changing the encoded amino acid sequence. What
amino acid sequences does Aat II (GACGTC) encode?
(Hint, there are three reading frames to consider: GAC GTC, G ACG TC, and GA
CGT C. Remember the DNA code is sometimes degenerate in the third position.
b. Show how blunt end ligation of the following sequence into a DNA sequence in
place of a codon 111, followed by restriction with Sap I, and religation
results in the incorporation of Ileucine or Tyrosine
at that codon.
TATTGAAGAGCAACCAAGCTCTTCATAT
ATAACTTCTCGTTGGTTCGAGAAGTATA
---ATG TTC---
---TAC AAG---
110 112
Chapter 15. Sequencing DNA.
6, 40, 56 (you also have terminal transferase and -32P-ddA), 105, 177,205,206,
255, 256, 257,
Chapter 16. SELEX. 190, 211, 212, 258
Chapter 17. Genetic Engineering.
143, 162, 210, 238, 259
a. Show how cleavage with Eco RI, followed by gap filling with DNA polymerase I
and dNTPs, and then blunt end ligation results in a site cleavable by Xmn I and Ase I.
b. What cleavage site would result from the same procedure applied to BamH I?
c. What site is produced by blunt end cleavage with Alu
I, followed by blunt-end ligation to an EcoRV
fragment?
d. Show how cleavage by Cla I followed by ligation to
a AccI fragment results in a
Taq I site.
Chapter 18. Protein Expression, fusion proteins,
phage display, semi-synthetic proteins 47, 52, 100, 162, 191, 209, 214, 215,
216, 260
Chapter 19. DNA photochemistry, 25 (photochemically produced, not by bleomycin) 34-37, 67, 80, 84, 109-111, 135, 174a, 235, 261, 262
Chapter 20. Radiation chemistry, 236, 264 (see also problems in radiomimetic chemistry).
Chapter 21. Radiomimetic agents, affinity cleaving, ene-diyne cleavers 21, 25, 31-33, 58, 81-83, 112, 113, 134, 146a, 158b, 167, 228, 229,230, 265, 267,
Chapter 22. Covalent and non-covalent binders. Metabolically activated binders, procarcinogens, and mutagens. Crosslinkers. 24, 50, 57, 60, 78, 79, 81, 86, 114, 132, 133, 137, 145, 146b, 169, 170, 174b, 194-196, 202, 231, 232, 233, 263, 270, 271
Chapter 23. DNA protein Interactions. 58, 59, 82, 173, 192, 193, 234, 268, 269
Chapter 24. DNA repair enzymes. 274
a) What is a suicide repair enzyme? Give an example
and mechanism.
b) How does T4 denV endonuclease V initiate the repair of a cyclobutane dimer
c) How does cis-syn dimer photolyase work?
d) How might the spore photoproduct lyase work?
e) How do AP lyases work?
f) What is an excision repair enzyme? Distinguish between base and nucleotide
excision repair.
Chapter 25. RNA Structure and
properties. 85, 72 (Change to: Give the structure of CT-A and G), 102,
116, 142d, 172, 197, 237, 272, 273