Chem 520 Problem Sets (2003)

Problem Sets for Chapters 1-9 (subject of the first exam).

Chapter 1. Structure of nucleotides and properties. 1-4, 40, 41a-c, 73a, 88, 89ac, 147, 148, 204, 217, 239

Chapter 2. Conformational analysis of nucleotides. 5, 7, 8, 75, 149, 176, 218, 240

Chapter 3.  A & B DNA. 9, 10, 11, 18 (see the Chapter notes), 41d-f, 46, 73bc, 74, 79, 98, 99, 179, 219, 220, 221

Chapter 4. A, B or Z DNA. 16, 29, 60, 180
Triplexes.
19a, 20, 38, 61, 62, 68, 103, 119, 120, 150, 151, 181, 183, 241

Chapter 5. Spectroscopic and chemical probes. 23, 17, 23, 110 (only DEPC), 182, 223, 242
Q.
What sequential NOESY assignments are possible for A, Z, triplex, and tetraplex DNA? (Need to use pdb structures on the Chem520 Web account and RasMac, or Chime to make the measurements).

Chapter 6. Thermodynamics. 12, 13, 14, 15, 26, 30, 71, 152, 184, 199, 224, 225, 243,

Chapter 7. Supercoiling. 19, 27, 28, 63, 69, 77, 87, 122, 123, 141, 153, 154, 185, 200, 226, 244

Chapter 8. Intercalation and minor groove binding. 202 , 245

Chapter 9. Bending. 64, 70, 121, 186, 227, 246
 

Problem Sets for Chapters 10-18 (subject of 2nd exam)

Chapter 10-12. Chemical Synthesis of nucleosides, DNA, RNA and analogs.
39 (reagents 4-9,11-13), 49, 53, 54, 144, 164, 165, 178, 198, 207,208, 247, 248, 249, 251, 252
a. What building blocks, supports and strategy would you use to make a 3'-3' linked oligonucleotide typified by that shown in problem 68?
b. How would you make the solid phase synthesis building block for the unnatural anomer of thymidine (pblm 83)?

Chapter 13. Nucleotide Biosynthesis and metabolism. 43, 90, 91, 92, 93, 124, 125, 142, 155, 156, 157, 158a, 187, 253, 254,

Chapter 14. Enzymatic synthesis of DNA and RNA, and protein: 45, 51, 56, 76b,c, 89 94, 95, 96, 97, 102, 106, 107, 114, 116,126, 127, 128, 150, 159, 160, 161,163, 189, 191, 201,
a. In the technique of silent mutagenesis, restriction sites can be introduced into a DNA sequence without changing the encoded amino acid sequence. What amino acid sequences does Aat II (GACGTC) encode? (Hint, there are three reading frames to consider: GAC GTC, G ACG TC, and GA CGT C. Remember the DNA code is sometimes degenerate in the third position.
b. Show how blunt end ligation of the following sequence into a DNA sequence in place of a codon 111, followed by restriction with Sap I, and religation results in the incorporation of Ileucine or Tyrosine at that codon.
TATTGAAGAGCAACCAAGCTCTTCATAT
ATAACTTCTCGTTGGTTCGAGAAGTATA
---ATG TTC---
---TAC AAG---
110 112

Chapter 15. Sequencing DNA.
6, 40, 56 (you also have terminal transferase and -32P-ddA), 105, 177,205,206, 255, 256, 257,

Chapter 16. SELEX. 190, 211, 212, 258

Chapter 17. Genetic Engineering. 143, 162, 210, 238, 259
a. Show how cleavage with Eco RI, followed by gap filling with DNA polymerase I and dNTPs, and then blunt end ligation results in a site cleavable by Xmn I and Ase I.
b. What cleavage site would result from the same procedure applied to BamH I?
c. What site is produced by blunt end cleavage with Alu I, followed by blunt-end ligation to an EcoRV fragment?
d. Show how cleavage by Cla I followed by ligation to a AccI fragment results in a Taq I site.

Chapter 18. Protein Expression, fusion proteins, phage display, semi-synthetic proteins 47, 52, 100, 162, 191, 209, 214, 215, 216, 260
 

 Problem Sets for Chapters 19-24 (subject of 3rd exam)

Chapter 19. DNA photochemistry, 25 (photochemically produced, not by bleomycin) 34-37, 67, 80, 84, 109-111, 135, 174a, 235, 261, 262

Chapter 20. Radiation chemistry, 236, 264 (see also problems in radiomimetic chemistry).

Chapter 21. Radiomimetic agents, affinity cleaving, ene-diyne cleavers 21, 25, 31-33, 58, 81-83, 112, 113, 134, 146a, 158b, 167, 228, 229,230, 265, 267,

Chapter 22. Covalent and non-covalent binders. Metabolically activated binders, procarcinogens, and mutagens. Crosslinkers. 24, 50, 57, 60, 78, 79, 81, 86, 114, 132, 133, 137, 145, 146b, 169, 170, 174b, 194-196, 202, 231, 232, 233, 263, 270, 271

Chapter 23. DNA protein Interactions. 58, 59, 82, 173, 192, 193, 234, 268, 269

Chapter 24. DNA repair enzymes. 274
a) What is a suicide repair enzyme? Give an example and mechanism.
b) How does T4 denV endonuclease V initiate the repair of a cyclobutane dimer
c) How does cis-syn dimer photolyase work?
d) How might the spore photoproduct lyase work?
e) How do AP lyases work?
f) What is an excision repair enzyme? Distinguish between base and nucleotide excision repair.

Chapter 25. RNA Structure and properties. 85, 72 (Change to: Give the structure of CT-A and G), 102, 116, 142d, 172, 197, 237, 272, 273
 

Return to Introduction